• Users Online: 390
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2020  |  Volume : 22  |  Issue : 2  |  Page : 216-219

Can subgenomic mRNA predict course of COVID-19? – An observational study from a tertiary care center


1 Department of Microbiology, Armed Forces Medical College, Pune, Maharashtra, India
2 Department of Community Medicine, INHS Asvini, Mumbai, Maharashtra, India
3 Dean and Dy Comdt, Armed Forces Medical College, Pune, Maharashtra, India

Date of Submission22-Nov-2020
Date of Decision11-Dec-2020
Date of Acceptance12-Dec-2020
Date of Web Publication18-Jan-2021

Correspondence Address:
Surg Cdr (Dr) Kavita Bala Anand
Department of Microbiology, Armed Forces Medical College, Pune, Maharashtra
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jmms.jmms_170_20

Rights and Permissions
  Abstract 


Background: The Covid 19 pandemic The COVID-19 pandemic continues to spread rapidly resulting in major socioeconomic impact globally. The infectivity, lack of effctive drugs and vaccines, and potentially large asymptomatic transmission have made the management and control of the disease extremely challenging. Although the primary control strategy is to isolate infected patients, the duration of the isolation period is poorly understood as viral RNA has been found to be persisting for prolonged durations. Recently many authors have studied the role of presence of subgenomic mRNA patient specimens to determine the infectivity of the patient. In our study we detected the presence of SARS-CoV-2 Envelope subgenomic mRNA in patients RT-PCR positive for SARS-CoV-2. These included symptomatic and asymptomatic patients. Aim: To detect the presence of E sg mRNA in SARS-CoV-2 RT PCR positive nasopharyngeal specimens. Materials and Methods: 58 consecutive RT-PCR positive samples were collected over a period of 10 days. These were further subjected to conventional RT-PCR testing for E subgenomic mRNA. Results: 22/58 tested positive for presence of sg mRNA. Out of these 22 positive for sg mRNA, 19 were symptomatic patients. We further compared the presence of sg mRNA in symptomatic cases at ≤ 5 days of symptom onset to testing time (STT) and in asymptomatic cases at ≤ 5 days from first Covid RT PCR positive test. There were total 44 samples including both groups, out of which 19/22 symptomatic patients showed presence of sg mRNA and 3/22 of asymptomatic showed presence of sg mRNA. Conclusion: In our study we observed that sg mRNA is detected mostly in symptomatic patients. However the limitation of our study is that a small sample size has been tested and cases have not been followed up. Large observational studies to detect sg mRNA in Covid 19 patients will help in validating its role in the disease process. Moreover the asymptomatic cases that show presence of subgenomic mRNA should be followed up longitudinally to observe whether they remain asymptomatic or develop symptoms subsequently.

Keywords: COVID-19, reverse transcription–polymerase chain reaction, SARS-CoV-2, subgenomic mRNA


How to cite this article:
Anand KB, Karade S, Sen S, Ray S, Patil P, Thosani P, Shergill S P, Gupta RM. Can subgenomic mRNA predict course of COVID-19? – An observational study from a tertiary care center. J Mar Med Soc 2020;22:216-9

How to cite this URL:
Anand KB, Karade S, Sen S, Ray S, Patil P, Thosani P, Shergill S P, Gupta RM. Can subgenomic mRNA predict course of COVID-19? – An observational study from a tertiary care center. J Mar Med Soc [serial online] 2020 [cited 2021 Apr 23];22:216-9. Available from: https://www.marinemedicalsociety.in/text.asp?2020/22/2/216/307328




  Introduction Top


The COVID-19 pandemic continues to spread rapidly resulting in an unprecedented socioeconomic impact globally. High infectivity, lack of effective drugs and vaccines, and potentially large asymptomatic transmission have made the management and control of the disease extremely challenging. Lockdown, isolation of cases, and quarantining contacts have impacted the economy to a large extent. Return to normal business is a strategy that is likely to have a positive psychological impact to the individual and the community as a whole and simultaneously boost the economy to a great extent. Although the primary control strategy is to isolate infected patients, the duration of the isolation period is poorly understood as viral RNA has been found to be persisting for prolonged durations with reverse transcription–polymerase chain reaction (RT-PCR) result returning positive reports lasting for weeks, with one case reported positive on the 63rd day.[1] RT-PCR detects the viral RNA and does not determine the replicating virus, which indicates infectiousness, and is a limitation of the test. Virus replication can be determined by virus culture. A study by Bullard et al. concluded that SARS-CoV-2 Vero cell infectivity was only observed for RT-PCR cycle threshold (Ct) <24 and Symptom onset to testing time (STT) <8 days.[2] During the previous pandemic of SARS, the virus having a close genomic relation with SARS-CoV-2, a similar study found that although viral RNA remained detectable in respiratory secretions and stool and urine specimens for >30 days in some patients, virus could not be cultured after week 3 of illness.[3] Based on this evidence, the WHO has updated its previous guidelines mandating a viral clearance in the form of negative RT-PCR reports to 10 days after onset of symptoms plus additional 3 days without symptoms for symptomatic patients and 10-day isolation in asymptomatic cases.[4]

Subgenomic mRNA (sg mRNA) is produced only in infected cells and is not packaged into new virion particles and hence is an indicator of active viral replication within host cells.[5] In a study by Perera et al., virus sg mRNA was detectable in 18 (81.8%) of 22 specimens collected ≤8 days after symptom onset and in 1 (9.1%) of 11 specimens collected ≥9 days after onset of disease.[6] We conducted this study to determine presence of sg mRNA in RT-PCR positive samples collected at different times after symptom onset.


  Materials and Methods Top


This observational study was carried out in an ICMR-approved laboratory of a medical college at Maharashtra for a period of 10 days. We collected 58 nasopharyngeal samples for the study from patients belonging to both asymptomatic and symptomatic disease categories. The samples from patients with and moderate severe disease were excluded. All individuals testing positive by RT-PCR with both E (envelope gene) and RNA dependent RNA polymerase (RdRp) gene with Ct values ≤35 and not instituted with antiviral medication were included.

RNA was extracted from nasopharyngeal samples using Qiagen Viral RNA Mini Kit. Real-time reverse transcriptase PCR was performed on the RNA extracts using ICMR-approved kits on QuantStudio 5. The RNA extracts were further subjected to conventional reverse transcriptase PCR for sg mRNA using a leader-specific primer, and primers targeting sequences downstream of the start codon of the E gene, as described (Wolfel et al., 2020). The sequences of primers used were as follows:

  • sgLeadSARSCoV2-F 5' to 3' CGATCTCTTGTAGATCTGTTCTC
  • SARSCoV2-R 5' to 3'ATATTGCAGCAGTACGCACACA.


The E gene sg mRNA PCR assay was done using the Superscript III one-step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany) with 400 nM concentrations of each of the primers. Thermal cycling conditions were as follows: 10 min at 50°C for reverse transcription, followed by 3 min at 95°C and 45 cycles of 10 s at 95°C, 15 s at 56°C, and 5 s at 72°C with an expected PCR product of 171 bp.

The details of day of symptom onset and 1st day of COVID-positive RT-PCR were obtained. We further compared the samples from symptomatic patients at ≤5 days of symptom onset to testing time (STT) and asymptomatic cases ≤5 days after first positive COVID-19 test, respectively. A cutoff of 5 days was taken based on a previous study by Wolfel et al. sgRNA was detected in the throat swabs of mild cases up to 5 days and was not detected henceforth. Thus, we decided to take cutoff of ≤5 days to understand the difference between detection of sgRNA in symptomatic versus asymptomatic cases. We received a total of 58 samples in 10 days out of which 22 samples were from symptomatic cases upto 5 days from STT and 22 samples were from asymptomatic cases upto 5 days from first Covid 19 RT-PCR positive report.


  Results Top


The study included 36 symptomatic and 22 asymptomatic cases [Table 1]. The sg mRNA was detected in 22/58 (37.95%) samples. Out of these, 3/22 (13.64%) were from asymptomatic patients and 19/22 (86.36%) were from symptomatic patients [Table 2]. The sg mRNA was not detected in 36 samples. The sg mRNA was not detected in 21/36 (62.05%) symptomatic cases and 15/36 (41.66%) asymptomatic patients.
Table 1: Detection of subgenomic mRNA

Click here to view
Table 2: Detection of subgenomic mRNA at ≤5 days

Click here to view


The Ct values were also significantly lower in the sg mRNA-positive group compared to the sg mRNA-negative group, though there were some outliers as indicated in the chart [Figure 1] and [Figure 2]. One asymptomatic 32-year-old pregnant female with Ct values of E/RdRp15/15 did not show sg mRNA on repeated testing even on serial dilution of sample. In one case with E/RdRp, Ct values as 12/14 did not amplify directly for sg mRNA, but dilution of the sample 1:10 and 1:100 showed amplification.
Figure 1: Distribution of (E gene) between the sgRNA positive (orange) cases and sgRNA negative (blue)

Click here to view
Figure 2: Day wise status of detection of sg mRNA in all COVID positive cases (n=58)

Click here to view



  Discussion Top


COVID-19 is unique due to the prolonged shedding of viral genomic RNA in the nasopharyngeal specimens. To determine the true ongoing active replication, many studies (6) have undertaken viral culture and sg mRNA detection studies. Some studies (5) have suggested that viral genomic RNA can be persistently positive due to extracellular virions which may be degrading, however, sg mRNA is present only in case of active intracellular replication process.

In our study, we observed that subgenomic RNA was present mostly in symptomatic patients with Ct values in the lower range. The sg mRNA was negative in one case, with Ct value at 15 being an asymptomatic case and another case with Ct value being 20 despite being tested on the 1st day and 4th day of onset of symptoms. In our study, 86.36% of mild cases showed the presence of sg mRNA in the nasopharyngeal swab (NPS) at ≤5 days of STT, compared to a study by Perera et al. in which the sg mRNA positivity at ≤8 days in mild cases was 81.9%, and 9.1% at ≥9 days after onset of symptoms in which the author tested different types of respiratory specimens.

Wolfel et al., in their study, looked specifically for the presence of the E gene sg mRNA by PCR, which was detected up to day 5 in throat swab samples.[5] In our study, none of the NPS samples were positive for sg mRNA after 5 days of onset of symptoms or first detection of viral genomic RNA (asymptomatics) [Figure 2]. In our study, sgRNA was detected 86.36% of mild cases at ≤5 days of STT compared to asymptomatics (13.64%) at ≤5 days after first COVID-positive RT-PCR, respectively. This probably supports the theory that asymptomatics have lesser degree of intracellular replication and cell death and thus no symptoms. Though the gold standard for determining the presence of viable virus remains viral culture, it cannot be done due to lack of BSL3 facilities in most laboratories. In our study, we found that sg mRNA was detected mainly in symptomatic patients. As our study had a small sample size, large observational studies to detect sg mRNA in symptomatic and asymptomatic patients will aid in validating its role in the disease process.

There have been studies which have suggested that detection of subgenomic RNA is a not direct evidence of active infection. Its presence is not detected despite the presence of viral genomic RNA due to its relatively low levels which go undetected by PCR but are detected using highly sensitive NGS.[7] However, the author has not correlated the infectivity of samples with viral cultures. Another study conducted by Perera et al. showed a moderate agreement between virus culture and sg mRNA detection, reinforcing the need to explore its presence as a marker of infectivity.[6]


  Conclusion Top


In our study, we were able to detect sg mRNA up to 5 days STT or up to 5 days after first positive RT-PCR for COVID-19 (in asymptomatic patients), which indicates that active replication is present in the initial part of the illness. Furthermore, sg mRNA was detected more in cases with lesser Ct values. The limitation of our study is the small sample size, and follow-up of patients at set points was not carried out. The presence of sg mRNA at ≤ 5 days of onset of symptoms (86.36% of mild cases in our study) indicates that active viral replication in tissues is at a higher level in symptomatic patients compared to asymptomatic cases; Hence, the isolation protocols for asymptomatic cases and symptomatic cases with mild illness can be as per the WHO guidelines, but those with severe illness or in an immune suppressed state would be prolonged and need to revisited. Furthermore, we suggest that the role of sg mRNA testing as a surrogate marker for active viral replication needs to be explored. Large-scale studies to determine sg mRNA in COVID-positive patients might give an insight to the infectious potential of the virus and aid in control measures.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Liu WD, Chang SY, Wang JT, Tsai MJ, Hung CC, Hsu CL, et al. Prolonged virus shedding even after seroconversion in a patient with COVID-19. J Infect 2020;81:318-56.  Back to cited text no. 1
    
2.
Bullard J, Dust K, Funk D, Strong JE, Alexander D, Garnett L, et al. Predicting infectious SARS-CoV-2 from diagnostic samples. Clin Infect Dis. 2020 May 22:ciaa638.  Back to cited text no. 2
    
3.
Chan KH, Poon LL, Cheng VC, Guan Y, Hung IF, Kong J, et al. Detection of SARS coronavirus in patients with suspected SARS. Emerg Infect Dis 2004;10:294-9.  Back to cited text no. 3
    
4.
Criteria for Releasing COVID-19 Patients from Isolation; 2020. Available from: https://www.who.int/news-room/commentaries/detail/criteria-for-releasing-covid-19-patients-from-isolation. [Last accessed on 2020 Sep 20].  Back to cited text no. 4
    
5.
Wölfel R, Corman VM, Guggemos W, Seilmaier M, Zange S, Müller MA, et al. Virological assessment of hospitalized patients with COVID-2019. Nature 2020;581:465-9.  Back to cited text no. 5
    
6.
Perera RA, Tso E, Tsang OT, Tsang DN, Fung K, Leung YW, et al. SARS-CoV-2 virus culture and subgenomic RNA for respiratory specimens from patients with mild coronavirus disease. Emerg Infect Dis 2020;26:2701-4.  Back to cited text no. 6
    
7.
Alexandersen S, Chamings A, Bhatta TR. SARS-CoV-2 genomic and subgenomic RNAs in diagnostic samples are not an indicator of active replication. medRxiv 2020;11:6059.  Back to cited text no. 7
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
 
 
  Search
 
Similar in PUBMED
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed236    
    Printed0    
    Emailed0    
    PDF Downloaded40    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]